What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

What's the difference between a Afghanistan wedding and a terrorist training camp?

Don't ask me, I'm just the drone pilot.

How does R. Kelly respond when girls ask for a rating on a ten scale?

Urinate

Bartender Jokes More Bartender Jokes

What did the bartender say to the giraffe when he ordered a beer?

Long neck or giraffed?

What did the Canadian eel say when the bartender asked him if he'd had enough?

No, I think I'd like some more-ay.