What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Previous Random Joke Next

Ask Jokes More Ask Jokes

What about the kids?

he asked. I said, "they're still together."

How can you tell if someone's a redditor,in real life?

Ask them if they're on reddit. I'm sorry.

Bartender Jokes More Bartender Jokes

Why does Jesus and bartenders have so much in common?

Bcoz they are single, have no kids, got nailed and serve alcoholic beverage.

What did the bartender say to the girl that tried to steal a drink?

It was worth a shot.