About ten minutes.
Couple's Daily Question Mug
Coffee Mug
With bar tender.
It was worth a shot.
You're drunk ET, go home!"
Because there's a BartEnder there.
No have to cut me off. Fall off barstool by myself. end metajoke
Bcoz they are single, have no kids, got nailed and serve alcoholic beverage.
A horse walks into a bar. Bartender: why the long face ? Horse: because I'm a raging alcoholic.
Serving dual porpoises!
Long neck or giraffed?
No boos for me.
Interactive Joke of the Day Mug
bartender: Why the long face Horse: My alcoholism is destroying my family.
Harambe: I'll have just ice. Bartender: Just ice Me: Yes, justice for Harambe.
the bartender says.
The bartender replies: "For you No charge."
Cat: Shot of rum. Bartender pours it Cat slowly pushes it off the bar Cat: Another.
OH SNaP!
I'd like a Corona, please.
asks the bartender. "I got fired."
A: Ok you 2 dont start anything
The bartender replies, "For you No charge."
No, I think I'd like some more-ay.
You better not try to start anything.
asks the bartender. The bear replies "Well, I am a bear"
asked the bartender. "From my husband," she replied. "But I thought he was out of town " he asked. "So did I!" she said.
We don't want any treble
You're cut off."
I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either
The bartender replies, "For you, neutron, no charge."
And the bartender says, I don't know, but I've heard he's a shady character!
Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.
You're not a bartender! You're just a pharmacist.
The bartender says, "Central Park."
Just say "I don't know, make something up"
The Bartender says, "For you No charge."
asks the neutron. "For you " replies the bartender, "no charge."
Xanax since he's a Bartender
AU, get outta here!"
That's the spirit!" How do you discourage a bartender Boos.
Bartender says, "dude, this is a gray bar.
I'm sorry, we don't serve food here
Pop,goes the weasel.
Bartender says, "here, but I’ll need that back in an hour!"
He was barred.
For his Borderline Personality Disorder.
Aarrrrrrr Kelly!
Because it takes too long to boil Boston Harbor.
Most people over 50 are scared of them and think they are destroying the fabric of society!
The Pittsburgh Steelers
He says Irish coffee is the only thing keeping this family together
All your chips and candy bars are family sized.
Because he clearly owed the win to Miller.
You do me and I owe you one.
Because I'm tired of running and he's catching up....
The magician returns your wallet at the end of the performance
she asked. "The side that pays your fee" replied the doctor.
he asked. And the new angel replied "Flu..."
to raise his spirits
To lift his spirits.
