How do you pay a bartender?

With bar tender.

Previous Random Joke Next

Pay Jokes More Pay Jokes

How do you get a Canadian to pay you back?

You ask.

Why did the woman refuse to pay for her Brazilian waxing?

A: Because it was a total rip-off.

Bartender Jokes More Bartender Jokes

What did the bartender say to the jumper cables when they walked into the bar?

A: Ok you 2 dont start anything

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Bar Tender Jokes More Bar Tender Jokes

What did the alcoholic Dad, away on business, say to the bartender at the hotel bar?

I'm ready to partiem with my perdiem *sorry, not a dad, and the bar tender didn't laugh either

How do you pay a bartender?

With bar tender.