What did the bartender say to the horse?

bartender: Why the long face Horse: My alcoholism is destroying my family.

Previous Random Joke Next

Horse Jokes More Horse Jokes

What's the difference between a horse?

The orange has handlebars

What do you call a horse with a broken leg?

Worthless

Family Jokes More Family Jokes

What do you call a family that runs a gas station?

Pump kin.

Where did the frog say his family came from?

They are German and a tad-Polish"

Bartender Jokes More Bartender Jokes

What can I get you ?

Harambe: I'll have a beer. Man: No, he'll have just ice. Bartender: Just ice Man: Yes, justice for Harambe.

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Destroy Jokes More Destroy Jokes

What will ISIS be called once it is destroyed?

WasWas

How does a woman destroy a mans pride with 4 words?

Is it in yet? How does a man destroy a womans pride with 4 words? I don't know.

Alcoholism Jokes More Alcoholism Jokes

What's the difference between alcoholism and a lobotomy?

I'd rather have a bottle in front of me than a frontal lobotomy.

How do you prevent alcoholism?

Shots.