What does a bartender give you when you need the feeling of a strong drink, but you're not allowed ton consume alcohol?

Xanax since he's a Bartender

Previous Random Joke Next

Allow Jokes More Allow Jokes

Why is gambling not allowed in Africa?

Because there are too many cheetahs.

What word allows you to take away two letters and get one?

Stone.

Feel Jokes More Feel Jokes

What did the picture say to the Judge?

I WAS FRAMED! I just now made that up. I feel good about this one! Skip

How did Luke Skywalker know what Darth Vader got him for Christmas?

He felt his presents.

Need Jokes More Need Jokes

What's Wayne Static's relationship with drugs?

I SEE IT!** ooooohh **I NEED IT!**(https://www.youtube.com/watch v=Ps0MfBG5-Uo#t=1m24s)

What do you need to drink out of a fruit?

a STRAWberry. ...I'll go...

Consume Jokes More Consume Jokes

Why don't more people cook Armenian food?

Because it can be very thyme-consuming.

How many fish did it take to consume my wife?

None. There are no fish under my new gazebo

Xanax Jokes More Xanax Jokes

Why does the American Border Patrol guard take Xanax?

To stop Hispanic attacks.

Why does a Mexican take Xanax?

For his Borderline Personality Disorder.

Bartender Jokes More Bartender Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What did the brown dwarf say to the bartender?

I'd like a Corona, please.