What does Shaggy ask himself when he's in a bind?

What would Scooby doo

Previous Random Joke Next

Ask Jokes More Ask Jokes

What does Ron Howard ask before watersports?

You down with Opie pee

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Doo Jokes More Doo Jokes

What are the Muppet's views on the paranormal?

It's a phenomena (do doo do doodoo)"

What does Shaggy ask himself when he's in a bind?

What would Scooby doo

Bind Jokes More Bind Jokes

What do you call a wheelchair bound Leo?

HanDicaprio. .

Why did the wheelchair-bound girlfriend break up with her boyfriend?

He kept pushing her around.

Scooby Jokes More Scooby Jokes

What does Shaggy ask himself when he's in a bind?

What would Scooby doo

Who is Scooby-Doo's evil twin?

A: Scooby-Don't.