I keep asking people, but they don't know either.
it's the one that's jalapeo business!!!
The doctor said, surprised. "I don't know, it started with a boil on my arse." the frog said.
The Cowboys Stadium. Because they can't catch anything there.
You haven't seen their fall wardrobe yet and tbh it could be a deal breaker
Sociopaths, fascist dictators, my boyfriend.
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
She said, "Whatever means necessary." "No it doesn't," I said.
He said, nag,nag,nag,nag!
idk, you dtf tho
Depends on how you throw (idk if this is a repost)
