Who does Luke Skywalker ask to charge his lightsaber?

Char-Jar Binks

Previous Random Joke Next

Ask Jokes More Ask Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Why the sad face?

asks the bartender. "I got fired."

Luke Skywalker Jokes More Luke Skywalker Jokes

How did Luke Skywalker know what Darth Vader got him for Christmas?

He felt his presents.

What did Luke Skywalker get for his 16th birthday?

A Toy-Yoda

Charge Jokes More Charge Jokes

Why can't an egg ever be in charge?

Because they crack under pressure.

Why were the Star Wars made IV, V, VI, I, II, III?

Because in charge of distribution, Yoda was.