I'm sure my neighbors ask the same question every time they catch me in their house...taking a shower.
My favorite is: "There's a maniac living in our neighborhood. He goes house-to-house leaving severed body parts on the doorstep. He gives me the willies."
Samson he brought the house down !
A: With a red elephant trap.
Paint him red and catch him with the red elephant trap.
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
A: So they don't get a concussion while bobbing their from head side to side as they are saying "I don't know " whenever you ask them a question.
It might Pikachu.
He followed the shampoo instructions.
Spocrates.
9/11
He said "Sure! I could loan some Dove".
The neighbor of the beast.
