What did the homeless man say to the woman who asked if he wanted 20$?

Yeah.

Previous Random Joke Next

Want Jokes More Want Jokes

Why do they ask you if you want paper or plastic at the supermarket?

Because baggers can't be choosers.

Why did the old man sneak past the cupboard?

He didn't want to wake up the sleeping pills.

Ask Jokes More Ask Jokes

What haircut did the Texan barber recommend when asked?

He couldn't think of anything, and said "I'll mullet over"

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Woman Jokes More Woman Jokes

What do you call a woman who thinks she can do anything a man can do?

Wrong.

What's the difference between a woman in church and a woman in the bath?

One has hope in her soul...

Homeless Man Jokes More Homeless Man Jokes

What did the homeless man get for christmas?

Nothing

What does a homeless man gets for Christmas?

A cold.

200 Jokes More 200 Jokes

How many applicants does it take to change a light bulb?

Only one but 200 applied for the job.

What has 200 legs 50 noses and is very loud?

A herd of stampeding aardvarks!