What's worse than locking your keys in you car outside an abortion clinic?

Having to go inside and ask for a coathanger

This joke may have profanity.
Previous Random Joke Next
Car Jokes More Car Jokes

What do you call someone who dances on cars ?

A morris dancer !

What kind of car does a Japanese chef drive?

Rolls Rice

Ask Jokes More Ask Jokes

What does a dirty hippie say after you ask him to get off your couch?

Namaste

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

Lock Jokes More Lock Jokes

What was the internet like in the old days?

Me: *opens door* *pushes 16 outside* *locks door*

What does getting pregnant and locking your car keys in your car have in common?

They can both be fixed with a coat hanger.

Key Jokes More Key Jokes

What key do you need to open a banana?

A monkey

Why was the band late to their gig?

Because the drummer locked himself in the car with the keys.

Abortion Clinic Jokes More Abortion Clinic Jokes
Coathanger Jokes More Coathanger Jokes

What can bring out your inner child?

A coathanger.

What's the difference between a potato and a vegetable...?

Not knowing how to use a coathanger...