and I would have gotten away with it if it weren't for you medaling kids!"
Couple's Daily Question Mug
Coffee Mug
Phelps.
This did not go swimmingly at all
Because it helps them remember which end they need to wipe.
Bro sure!
Organized crime.
A: He was selling quack.
More than likely you won't see any stars.
I was robbed" Sorry, that just came to me like a stroke of idiotic genius and I couldn't help myself.
The 2016 Olympics.
LeBronze James
They ketchup.
It became entally handicapped
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*
Shoot for the Tsars.
Go to your room.."
Tell me a lie. Tell me the truth. Tell me a lie. Tell me the truth. Tell me a lie...
The truth is out there.