Lochte Jokes

What did Lochte say after his teammates told the police what really happened?

and I would have gotten away with it if it weren't for you medaling kids!"

Couple's Daily Question Mug

5.0

Coffee Mug

Who robbed Lochte at the Olympics?

Phelps.

What else did Lochte say after the truth came out?

This did not go swimmingly at all

You might also enjoy:

Help Jokes More Help Jokes

Why do men whistle when they're sitting on the toilet?

Because it helps them remember which end they need to wipe.

What did the pamphlet say to the booklet when it asked for help?

Bro sure!

Jail Jokes More Jail Jokes

What did the OCD man get thrown in jail for?

Organized crime.

Why did the duck go to jail?

A: He was selling quack.

Dancing Star Jokes More Dancing Star Jokes

What do a Cloudy Night and Dancing With The Stars have in common?

More than likely you won't see any stars.

What will Ryan Lochte say if he looses "Dancing With the Stars"?

I was robbed" Sorry, that just came to me like a stroke of idiotic genius and I couldn't help myself.

Olympic Jokes More Olympic Jokes

Where's the best place to go if you want a little head?

The 2016 Olympics.

Who placed 3rd for basketball in the 2016 Olympics?

LeBronze James

Happen Jokes More Happen Jokes

What happens when you run away from tomatos?

They ketchup.

What happened to the tree after it caught fire?

It became entally handicapped

Bartender Jokes More Bartender Jokes

What will it be?

asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.

What's a girl gotta do to get a drink?

Me: You just give the bartender your order. Her: ... Me: It's really pretty easy. Her: *leaves*

Tell Jokes More Tell Jokes

What do they tell Soviet children who want to achieve their dreams?

Shoot for the Tsars.

How many times I have to tell you to stop making such a mess?

Go to your room.."

Truth Jokes More Truth Jokes

What did Cinderella say when she sat on Pinocchio's face?

Tell me a lie. Tell me the truth. Tell me a lie. Tell me the truth. Tell me a lie...

What does the Fox say?

The truth is out there.