Jupiter
Couple's Daily Question Mug
Coffee Mug
They keep the tips.
Rabies!
July
a brucea
He-brews it
Hebrewed his own
Hebrews it
Been awhile since I've her some priest and a rabbi jokes. Hit me with your best one! Mine: a priest and a rabbi are waking down the street The priest asks " wanna screw some kids?" The rabbi replies "out if what?"
Hebrew".
The L'Hyatt
Interactive Joke of the Day Mug
With out their tea they'd be Rabbis.
Because he likes oldfashioned jokes.
Oy vey!"
A kiwi !
They've always enjoyed rounding up Japanese monsters.
A cheetah !
And the dad says: 'Wealth is caviar, champagne and women. Poverty is hot pocket, beer and your mother!'
If you invite only one, you'll have to share your beer.
None. People that glow in the dark don't need lights.
Me, and only me!
A frothel
I'm often asked by people: "Why are your eyes covered in ketchup " So I tell them it's because Heinz sight is 20/20.
asks the bartender. "ATCGGCAGGCTTCAGTTGCA" says the DNA molecule.
When you throw your knickers against the wall, and they stay there.
Because he was resisting a rest.
acidic juice
They're full of acidic juice.
